Journal: Pharmaceutics

Article Title: Repurposing of Ciclopirox to Overcome the Limitations of Zidovudine (Azidothymidine) against Multidrug-Resistant Gram-Negative Bacteria

doi: 10.3390/pharmaceutics14030552

Figure Lengend Snippet: Minimum inhibitory concentrations (MICs) of test antibiotics against Gram-negative bacterial strains.

Article Snippet: As shown in b, strongly AZT-resistant E. coli from ATCC 25922 cells (here named AZT-R E. coli ) were generated within 2 d with an AZT MIC >1000-fold higher than that of control cells and >20-fold higher than that of Keio- tdk ( ; ).

Techniques: Laser Capture Microdissection

Journal: Pharmaceutics

Article Title: Repurposing of Ciclopirox to Overcome the Limitations of Zidovudine (Azidothymidine) against Multidrug-Resistant Gram-Negative Bacteria

doi: 10.3390/pharmaceutics14030552

Figure Lengend Snippet: Confirmation of Mcr-1 expression in E. coli ATCC 25922. ( a ) Confirmation of mcr-1 expression from the related plasmid. PCR amplification using pQE-60-specific primer sets was performed for KS7001 (pQE-60, lane 1) and KS8001 (pQE-60- mcr-1 , lane 2), which overproduced a His-tagged Mcr-1 protein , on 1% agarose gel wis shown. M and asterisk (*) indicate the DNA size marker (GeneRuler 1kb Plus DNA ladder; Thermo Scientific, MA, USA) and a non-specific PCR product, respectively. ( b ) Detection of Mcr-1 protein. Mcr-1 protein from KS8001 was detected by Western blotting with an Anti-His tag Antibody (Sino Biological, Wayne, PA, USA). Image acquisition and quantitative analysis were performed by using ChemiDoc TM MP Imaging System (Bio-Rad, Hercules, CA, USA) and Image Lab TM Software (ver 5.2.1; Bio-Rad, Hercules, CA, USA).

Article Snippet: As shown in b, strongly AZT-resistant E. coli from ATCC 25922 cells (here named AZT-R E. coli ) were generated within 2 d with an AZT MIC >1000-fold higher than that of control cells and >20-fold higher than that of Keio- tdk ( ; ).

Techniques: Expressing, Plasmid Preparation, Amplification, Agarose Gel Electrophoresis, Marker, Western Blot, Imaging, Software

Journal: Pharmaceutics

Article Title: Repurposing of Ciclopirox to Overcome the Limitations of Zidovudine (Azidothymidine) against Multidrug-Resistant Gram-Negative Bacteria

doi: 10.3390/pharmaceutics14030552

Figure Lengend Snippet: Generation of resistance phenotypes by AZT or CPX. ( a ) Schematic representation of the resistance generation method. Bactericidal activity of ( b ) AZT or ( c ) CPX against E. coli ATCC 25922. Representative data from n = 3 experiments, as described in are shown. Relative increase of resistance of ATCC 25922 to ( d ) AZT or ( e ) CPX. The relative increase of resistance as a fold change with respect to non-drug-treated ATCC 25922 or Keio- tdk cells (set to 1 for each set) was calculated based on MIC changes from ( b , c ). The values shown in the graph at the indicated days are averaged values from n = 3 experiments, with standard deviations ( p < 0.05).

Article Snippet: As shown in b, strongly AZT-resistant E. coli from ATCC 25922 cells (here named AZT-R E. coli ) were generated within 2 d with an AZT MIC >1000-fold higher than that of control cells and >20-fold higher than that of Keio- tdk ( ; ).

Techniques: Activity Assay

Journal: Pharmaceutics

Article Title: Repurposing of Ciclopirox to Overcome the Limitations of Zidovudine (Azidothymidine) against Multidrug-Resistant Gram-Negative Bacteria

doi: 10.3390/pharmaceutics14030552

Figure Lengend Snippet: Bactericidal activity of CPX in AZT resistant strains. ( a ) PCR amplification of the tdk -encoding gene. Sequence information for ATCC 25922 was obtained from the NCBI database (accession No. CP009072.1). Sequence alignment of ( b ) the tdk gene. DNA sequencing results of tdk -encoding region from AZT-R and ATCC 25922, read using the primers Keio- tdk -F and -R, were aligned using Clustal Omega (ClustalW2, v2.1, http://www.clustal.org ; accessed on 10 January 2022) . ( c ) Bactericidal activity of CPX. The bactericidal activity of CPX in AZT-resistant E. coli cells (AZT-R or AZT- tdk -R) and control cells (ATCC 25922) was determined at the indicated concentrations. Data shown here are from one representative experiment from triplicate experiments. The LB agar plates were imaged with a digital camera (Samsung NX200, Suwon, Korea).

Article Snippet: As shown in b, strongly AZT-resistant E. coli from ATCC 25922 cells (here named AZT-R E. coli ) were generated within 2 d with an AZT MIC >1000-fold higher than that of control cells and >20-fold higher than that of Keio- tdk ( ; ).

Techniques: Activity Assay, Amplification, Sequencing, DNA Sequencing

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) In human small intestine (SI) and colonic crypts, ZNF277 is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Immunohistochemistry, Expressing, Immunofluorescence, Staining

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) ZNF277 RNA interference reduces ZNF277 protein expression in human colon cancer cells. Immunoblots of extracts from HT29, H508, and SNUC4 human colon cancer cells after ZNF277 knockdown with the indicated concentrations of ZNF277 siRNA and 50 nM mock siRNA. ( B ) ZNF277 deficiency attenuates human colon cancer cell proliferation. Cells were transfected for 24 hours with siRNA, and cell proliferation was measured after an additional 24-hour incubation. * P < 0.05 versus control siRNA. Data represent mean ± SEM from 3 separate experiments. ( C ) Immunoblotting confirms ZNF277 overexpression in HT29 cells transfected with plasmid containing full-length human ZNF277 cDNA. ( D ) Overexpressing ZNF277 stimulates HT29 cell proliferation. * P < 0.05 versus control cells. Data represent mean ± SEM from 3 separate experiments. ( E ) Immunoblots reveal lack of ZNF277 expression in 4 HEK293 lines following CRISPR KO of ZNF277 . ( F ) CRISPR KO of ZNF277 attenuates HEK293 cell proliferation. * P < 0.05 versus control cells. ** P < 0.05 versus line 1-2. Data are shown as mean ± SD from 7 separate experiments. Data were analyzed using 2-tailed t tests and 1-way ANOVA with post hoc Tukey test. β-Actin and lamin B1 were used as loading controls in A and C , respectively.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Expressing, Western Blot, Knockdown, Transfection, Incubation, Control, Over Expression, Plasmid Preparation, CRISPR

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) Immunoblots of HT29 cell extracts without (control) or with CRISPR knockdown of ZNF277 expression. β-Actin was used as a loading control. ( B ) ZNF277 deficiency attenuates HT29 cell proliferation in vitro from 7 separate experiments. ( C ) ZNF277 deficiency attenuates xenograft growth. Time-course reveals reduced volume of ZNF277 CRISPR HT29 cell–derived xenografts ( n = 8) compared with control xenografts ( n = 7). ( D ) Representative images of s.c. and excised xenografts from HT29 ZNF277 CRISPR versus control cells. Arrows and arrowheads indicate control and HT29 ZNF277 CRISPR xenografts, respectively. ( E ) Reduced weights of xenografts with ZNF277 deficiency ( n = 8). * P < 0.01 versus controls ( n = 7); 2-tailed Student’s t test. ( F ) Representative microscopic images of control and ZNF277 -deficient xenografts stained for H&E, p21 WAF1 , and p53. ( G ) ZNF277, p21 WAF1 , p53, and β-catenin immunoblots of proteins extracted from ZNF277 CRISPR cell– and control cell–derived tumors (2 separate tumors from each group). Values represent mean ± SD. Scale bar: 100 μM.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Western Blot, Control, CRISPR, Knockdown, Expressing, In Vitro, Derivative Assay, Staining

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) β-Catenin ( CTNNB1 ) knockdown decreases ZNF277 levels in human HT29, H508, and SNUC4 colon cancer cells. ( B ) ZNF277 knockdown does not alter β-catenin levels in HT29 and H508 colon cancer cells. Maximum siRNA concentration was 50 μM. ( C ) Increased β-catenin signaling augments Zfp277 expression. Zfp277 expression in colon mucosal extracts from WT, Apc Min/+ , and Zfp277 –/– mice. β-Actin was used as a loading control. ( D ) ZNF277 promoter elements for β-catenin. ChIP assay using random DNA fragments generated by MNase digestion in HT29 cells. ZNF277 promoter positions are indicated in the text and DNA sequences of qPCR primers are listed in . Data are shown as mean ± SEM from 3 separate experiments. ( E ) ZNF277 coimmunoprecipitates with BMI1 in SNUC4 colon cancer cells. Rabbit immunoglobulins (IgG) were used as control.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Knockdown, Concentration Assay, Expressing, Control, Generated

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) siRNA and CRISPR knockdown of ZNF277 expression augments p21 WAF1 levels in HT29, H508, and HEK293 cells. β-Actin was used as a loading control. ( B ) Levels of murine p21 WAF1 expression are augmented in colon tissue extracts from Apc Min/+ and Zfp277 –/– mice. Experiments were performed using tissues from 2 separate 8-week-old mice of each genotype. ( C ) Upregulated p21 WAF1 expression after p53 and ZNF277 knockdown in HT29 cells. All siRNAs were 25 nM, except lane 4 (50 nM). ( D ) ZNF277 knockdown augments p21 WAF1 mRNA levels in HT29 cells. Data are shown as mean ± SEM from 3 separate experiments. * P < 0.01 (2-tailed Student’s t test). ( E ) Zfp277 deficiency stimulates cellular senescence. β-Galactosidase staining in control HT29 cells ( A ) and HT29 cells with CRISPR knockdown of ZNF277 ( B ). Scale bar: 50 μM. ( F ) Zfp277 deficiency increases p21 WAF1 expression. IHC of p21 WAF1 in the normal small intestine of WT ( A ) and Zfp277 –/– ( B ) mice, as well as in small intestine adenomas from Zfp277 +/+ Apc Min/+ ( C ) and Zfp277 –/– Apc Min/+ ( D ) mice. Arrows indicate adenomas. Scale bar: 100 μM.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: CRISPR, Knockdown, Expressing, Control, Staining

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: Posterior Hoxd genes are Zfp277 transcriptional targets. ( A ) Heatmap of differentially expressed genes in colon mucosa from 3 WT mice and 3 Zfp277 –/– littermates. ( B ) Top 16 upregulated genes from RNA-Seq, excluding immunoglobulins. Genes in the Hoxd cluster are highlighted in red. ( C ) Schematic of the murine Hoxd posterior gene clusters. ( D ) qPCR of Hoxd13 mRNA expression in colon mucosal tissue from WT and Zfp277 –/– mice. Values represent mean ± SEM ( n = 3 each). ( E ) ZNF277 represses HOXD13 gene expression. HOXD13 immunoblot of proteins extracted from ZNF277 CRISPR cell- and control cell–derived xenograft tumors (2 separate tumors from each group). ( F ) Model illustrating the role of ZNF 2 77/Zfp277 in intestinal tumorigenesis. ZNF277 , normally expressed in TACs but not in differentiated enterocytes, maintains intestinal homeostasis. Aberrant WNT signaling stimulates ZNF277 overexpression in TACs. ZNF277 interacts with BMI1 in the PRC1 complex and represses p21 WAF1 expression, thereby stimulating cell proliferation and attenuating cell senescence, as well as enhancing tumorigenesis and progressive neoplasia.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: RNA Sequencing, Expressing, Gene Expression, Western Blot, CRISPR, Control, Derivative Assay, Over Expression

Journal: PLoS ONE

Article Title: A Novel Network Integrating a miRNA-203/SNAI1 Feedback Loop which Regulates Epithelial to Mesenchymal Transition

doi: 10.1371/journal.pone.0035440

Figure Lengend Snippet: HTB129-ctrl and HTB129-miR203 cells were subjected to A) qRT-PCR analyses of SNAI1 mRNA expression in HTB129-ctrl and HTB129-miR203 cells, B) fluorescent staining with DAPI (blue) and phalloidin (red) (scale bar, 20 µm), C) migration and D) invasion assays. E) Predicted miR-203 target sites within SNAI1 3′UTR. F, G) Relative luciferase activity of SNAI1-3′UTR wild type (wt) or mutant (mut) in MDA231 cells transfected with control (F, G), miR-203 (F) or miR-200a/c (G) precursors. Co-transfection with GAPDH 3′UTR vector served as additional negative control (*, p<0.05; **, p<0.01).

Article Snippet: The human breast cancer cell lines HTB129 and MDA231 (also named MDA-MB-231 or HTB-26), purchased from the ATCC, were maintained in RPMI1640 and Leibovitz culture media (Lonza), respectively, supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin.

Techniques: Quantitative RT-PCR, Expressing, Staining, Migration, Luciferase, Activity Assay, Mutagenesis, Transfection, Control, Cotransfection, Plasmid Preparation, Negative Control

Journal: Cell

Article Title: Dynamic allostery drives autocrine and paracrine TGF-β signaling

doi: 10.1016/j.cell.2024.08.036

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: The following cDNA constructs were used: β8 cDNA pBABE puro, αvfl pcDM8, αvtr pcDM8, β8tr pcDNA1neo, β8fl pcDNA1neo , ; pLX307 hTGF-β1 IRES2 EGFP (h preceding protein name indicates human from here forward) was constructed from TGF-β1_pLX307 (Plasmid #98377, AddGene) to remove a c-terminal V5 tag by cloning a PCR fragment created with primers (5’- caggtgtcgtgaggctagcatcg-3’, and 5’-gcgccactagtctcgagttatcag-3’) which was used as a backbone to generate pLX307 hTGF-β1 RGE_IRES2 EGFP puro, pLX307 hTGF-β1 RGD_R249A_IRES2 EGFP puro, pLX307 hTGF-β1 RGE_R249A_IRES2 EGFP puro, as described , L-TGF-β1_RGD_Lasso3 (where the A31-L44 in lasso1 loop was swapped with T31-V42 from the L-TGF-β3 lasso3 loop) was made by splice overlap extension PCR using the primers (5’-ccatttcaggtgtcgtgaggc-3’, 5’-ccctgagccaacggtgatgacccacgtccccgaggccgtgctcgc-3’, 5’- gtcatcaccgttggctcaggggggctggtgagccgcagcttggacag-3’, 5’-tggcgtagtagtcggcctc-3’).

Techniques: Lysis, Blocking Assay, Staining, Cell Isolation, Recombinant, Protease Inhibitor, BIA-KA, Virus, Cloning, Luciferase, SEAP Assay, Plasmid Preparation, Software

Journal: Antibiotics

Article Title: A Single Plasmid of Nisin-Controlled Bovine and Human Lactoferrin Expressing Elevated Antibacterial Activity of Lactoferrin-Resistant Probiotic Strains

doi: 10.3390/antibiotics10020120

Figure Lengend Snippet: Selection of probiotic strains with transformed vectors as the stable clones.

Article Snippet: The probiotic bacterial strains used in this study, including Lactobacillus delbrueckii (BCRC 14008), Lactiplantibacillus paraplantarum (old species name: Lactobacillus paraplantarum ; ATCC 700210) [ ], Lactobacillus gasseri (laboratory stock, isolated from human milk), Lacticaseibacillus rhamnosus (old species names: Lactobacillus rhamnosus (ATCC 53103) [ ], Pediococcus pentosaceus (ATCC 8081), Bifidobacterium angulatum (ATCC 27535), Bifidobacterium breve (BCRC1258), and Bifidobacterium catenulatum (ATCC 27539), were cultured in deMan–Rogosa–Sharpe (MRS) medium (Oxoid) at 37 °C without agitation.

Techniques: Selection, Transformation Assay, Clone Assay, Plasmid Preparation

Journal: iScience

Article Title: Pharmaceutical inhibition of the Chk2 kinase mitigates cone photoreceptor degeneration in an iPSC model of Bardet-Biedl syndrome

doi: 10.1016/j.isci.2025.112130

Figure Lengend Snippet:

Article Snippet: Anti-cleaved Caspase3 , Cell Signaling , 9661.

Techniques: Plasmid Preparation, Recombinant, Full Display Name, TUNEL Assay, Imaging, Ab Array, Generated, Software, Microscopy, Extraction